pgdS [2018-06-18 14:53:33]

gamma-DL-glutamyl hydrolase

locus: BSU35860

pI: 8.52

mw: 45.09 kDa

protein length: 413 aa

gene length: 1239 bp

function: polyglutamic acid degradation

product: gamma-DL-glutamyl hydrolase

essential: no

synonyms: ywtD

Genomic Context

categories

• [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.4|Capsule biosynthesis and degradation]
• [category|SW 6|Groups of genes] → [category|SW 6.12|Secreted proteins]

Gene

Coordinates: 3,696,257 → 3,697,498

The protein

Protein family

• nlpC/p60 family (according to Swiss-Prot)

[SW|Domains]

• three [SW|NlpC/P60 domain]s [pubmed|29458655]

[SW|Localization]

• secreted (according to Swiss-Prot), extracellular (signal peptide) [Pubmed|18957862]

Expression and Regulation

Operons

• genes: [gene|86B1182DA7283078B0D393DEB607664059AB910E|pgdS]
  description: [Pubmed|15033535]

  sigma factors

  • [protein|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD]: sigma factor, [Pubmed|15033535], in [regulon|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD regulon]

Biological materials

Mutant

• MGNA-A545 (ywtD::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/545 NBRP B. subtilis, Japan]
• BKE35860 (Δ[gene|86B1182DA7283078B0D393DEB607664059AB910E|pgdS]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE35860 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTTTTATTATCTCCTCCT, downstream forward: _UP4_TAAAAGAAAAAGACTCCAAT
• BKK35860 (Δ[gene|86B1182DA7283078B0D393DEB607664059AB910E|pgdS]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK35860 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTTTTATTATCTCCTCCT, downstream forward: _UP4_TAAAAGAAAAAGACTCCAAT

lacZ fusion

• available in [SW|Daniel Kearns]'s lab [Pubmed|24296669]

References

Reviews

• 16689787,29215550

Original publications

• 18957862,12644511,15033535,23335395,29608608,29458655